Your full-stack
RNA partner

Laboratory technician operating the Ntensify midi, part of the Ntensify product line showing how we are reinventing the mRNA production

Quantoom is on a mission to reinvent RNA technologies to enable the rapid development of (sa)mRNA as a drug-modality for life-changing RNA-based medicines reaching more patients worldwide, making the synthetic biology revolution a reality.​

While others think about 10%, we aim for >10x improvement that can completely transform the production of life-changing (sa)mRNA drugs.​

Quantoom is your full-stack RNA partner, dedicated to accelerating and de-risking your RNA drug development journey. By minimizing scale-up, time, and cost uncertainties — and maximizing your chances of success — our transformative N-Force toolbox empowers you from design to delivery.



A powerful toolbox of technologies, to fast track your RNA development from design to delivery

Our toolbox of technologies provides our partners with a comprehensive set of solutions to enable RNA adoption, starting from a simple antigen sequence. It provides solution for molecular design, RNA production and formulation as well as support in derisking studies in-vitro and in-vivo.

Ncode logo white

Ncode, RNA design platform
Logo Ntensify

Ntensify mRNA production systems
Ncapsulate logo white

RNA Formulation Delivery - part of our full-stack mRNA partner offer

Our N-Force toolbox has demonstrated performances in numerous pre-clinical and target-species evaluation

CAUGCAUGGCUAACGUAGCUAGCAUGCUAACGUAGCUAGCAUGC
UACGUAGCUAGCAUGCUAACGUAGCUAGGCUAACGUACGUAGCU

How to design a plasmid

Download our general plasmid design guidelines for the Ntensify® process.